Stem-loop sequence atr-MIR8565b

AccessionMI0027449 (change log)
DescriptionAmborella trichopoda miR8565b stem-loop
Gene family MIPF0001889; MIR8565
Stem-loop
   ------aggaauagacaacuacuauuuguuaauuaaaua     a      a    a                   u               g                                       ----     u 
5'                                        aagag aaugac cuau agacccucccacacccaug gaguaggaccccaaa gaucaccauuaaauuuggcacagaucucuagaaaaguua    ucaca g
                                          ||||| |||||| |||| ||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||    |||||  
3'                                        uucuc uuacug gaua ucugggaggguguggguac cucauccugggguuu cuagugguaguuuaaaccgugucuagagaucuuuucagu    ggugu g
   ucguuauuauuaaauuaauaaauaaaucauuuaaauaaa     a      g    c                   c               a                                       ucag     g 
Get sequence
Deep sequencing
12493 reads, 4.48e+03 reads per million, 4 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00033: 3597900-3598175 [+]
intergenic
Database links

Mature sequence atr-miR8565b

Accession MIMAT0033847
Sequence

101 - 

uuuggcacagaucucuagaaaagu

 - 124

Get sequence
Deep sequencing7312 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).