Stem-loop sequence atr-MIR8565c

AccessionMI0027450 (change log)
DescriptionAmborella trichopoda miR8565c stem-loop
Gene family MIPF0001889; MIR8565
Stem-loop
   ----------------guuauaaaauauucuuaguauuaucuuaagaguaaugauccucu        c     c                         c  auu                              ----     u 
5'                                                             gagacccu ccaca ccauguguguaggacuccaaaggau ac   uaaauuuggcacagaucucuagaaaaguua    ucaua g
                                                               |||||||| ||||| ||||||||||||||||||||||||| ||   ||||||||||||||||||||||||||||||    |||||  
3'                                                             cucuggga ggugu gguacacacauccugggguuuucua ug   auuuaaaccgugucuagagaucuuuucagu    ggugu g
   uaaaauuuuaaaagauuaauccauacuuuuaucuaaaauucuauucccuuuccugcaaua        a     a                         a  guu                              ucaa     g 
Get sequence
Deep sequencing
13537 reads, 4.5e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00080: 3094205-3094478 [+]
intergenic
Database links

Mature sequence atr-miR8565c

Accession MIMAT0033848
Sequence

95 - 

uuuggcacagaucucuagaaaagu

 - 118

Get sequence
Deep sequencing6810 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).