Stem-loop sequence atr-MIR8565d

AccessionMI0027451 (change log)
DescriptionAmborella trichopoda miR8565d stem-loop
Gene family MIPF0001889; MIR8565
Stem-loop
   -----------g   a    acua                        uc              a     c             c                              caaauc     c 
5'             guu uuua    aagaguaaugauccuaugagaccc  ccacacccaugugu uagga cccaaaggaucac auuaaauuuggcacagaucucuagaaaagu      uuaca c
               ||| ||||    ||||||||||||||||||||||||  |||||||||||||| ||||| ||||||||||||| ||||||||||||||||||||||||||||||      |||||  
3'             caa aaau    uucucauuacuaggauacucuggg  gguguggguacaca auccu ggguuuccuagug uaauuuaaaccgugucuagagaucuuuuua      agugu c
   ccgaucgaaaua   -    -caa                        ca              c     a             a                              ----au     a 
Get sequence
Deep sequencing
11204 reads, 3.72e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00131: 971786-972024 [+]
intergenic
Database links

Mature sequence atr-miR8565d

Accession MIMAT0033849
Sequence

81 - 

uuuggcacagaucucuagaaaagu

 - 104

Get sequence
Deep sequencing7304 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).