Stem-loop sequence atr-MIR8565e

AccessionMI0027452 (change log)
DescriptionAmborella trichopoda miR8565e stem-loop
Gene family MIPF0001889; MIR8565
Stem-loop
      a      -ag    aguaauaauaauaaa                        c           a              g     c                                 ----     u 
5' aug auuuuu   uuuc               gaguaaugauccuaugagacccuc cacacccaugu uguaggaccccaaa gauca cauuaaauuuggcacagaucucuagaaaaguua    ucaca g
   ||| ||||||   ||||               |||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||| |||||||||||||||||||||||||||||||||    |||||  
3' uac uagaag   aaag               cucauuacuaggauacucugggag guguggguaca acauccugggguuu cuagu guaauuuaaaccgugucuagagaucuuuucagu    ggugu a
      g      aaa    -aaaauaaauaauaa                        a           c              a     a                                 ucag     g 
Get sequence
Deep sequencing
11931 reads, 5e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00159: 262391-262652 [+]
intergenic
Database links

Mature sequence atr-miR8565e

Accession MIMAT0033850
Sequence

97 - 

uuuggcacagaucucuagaaaagu

 - 120

Get sequence
Deep sequencing7312 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).