Stem-loop sequence atr-MIR8565f

AccessionMI0027453 (change log)
DescriptionAmborella trichopoda miR8565f stem-loop
Gene family MIPF0001889; MIR8565
Stem-loop
                                        --   a   a 
5' aucaccauuaaauuuggcacagaucucuagaaaaguu  guc cau g
   |||||||||||||||||||||||||||||||||||||  ||| |||  
3' uagugguaauuuaaaccgugucuagagaucuuuucag  cag gug g
                                        uu   g   u 
Get sequence
Deep sequencing
8115 reads, 1.5e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00164: 370959-371052 [+]
intergenic
Database links

Mature sequence atr-miR8565f

Accession MIMAT0033851
Sequence

13 - 

uuuggcacagaucucuagaaaagu

 - 36

Get sequence
Deep sequencing7297 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).