Stem-loop sequence atr-MIR8570

AccessionMI0027454 (change log)
DescriptionAmborella trichopoda miR8570 stem-loop
Stem-loop
   -uaua    a     au         c     aua   ag    u        ---ca      ccuag               u   - g   u a    -            ca     -            c         u         a     a    cg   a  a a    c    aaaccuacuuguauuaaaaauacauggugucuuuuguauucauuuucauguguauauauau 
5'      uagg auugu  acuaugaga cauuu   uuu  ugua ggagguca     gcuacu     ccauuagaugucaaa uga u gcu g gggu ugucacaaaguu  agaaa uuuuuuuuugaa uuugagucu gucaaugac cacuc caac  ccc au u aaau ugac                                                             a
        |||| |||||  ||||||||| |||||   |||  |||| ||||||||     ||||||     ||||||||||||||| ||| | ||| | |||| ||||||||||||  ||||| |||||||||||| ||||||||| ||||||||| ||||| ||||  ||| || | |||| ||||                                                              
3'      aucc ugaca  ugauacucu guaaa   aag  augu ccuccagu     cgaugg     gguaaucuacaguuu acu a cgg c cccg acaguguuucaa  ucuuu aaaagaagauuu aaauucaga caguuacug gugag guug  ggg ua a uuua acug                                                             u
   auaug    c     ac         u     cag   ca    u        auuaa      ---ua               c   u g   u -    u            aa     u            c         u         c     g    au   c  a c    c    ccuguucucacuaacacuggagaaacauaauuuguauuuaucagagaaagauacgaaaaag 
Get sequence
Deep sequencing
1525 reads, 3.02e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00002: 9634329-9634811 [-]
intergenic
Database links

Mature sequence atr-miR8570

Accession MIMAT0033852
Sequence

322 - 

aguugggagugcgucauugacuag

 - 345

Get sequence
Deep sequencing869 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).