Stem-loop sequence atr-MIR8571

AccessionMI0027455 (change log)
DescriptionAmborella trichopoda miR8571 stem-loop
Stem-loop
   u      c  cu           a u              aaa          a  g                g  --       c   agaacacc    a     c u  ca    cuc      a      u    ug    --     caa       u                      ugau   c      c    a       c      caug     --uaauucc   u      --uu     cu          aa     cc                  agg   g au 
5'  uuaaca uu  ccucaaacuca c uagaagaaccaaac   uaguucuuca uc ucaaguauccaugccu ac  uaccaaa auu        agga uugag c ga  ucau   guauaa cuaucu cuaa  agcu  ccccg   aauagaa uggaucaaacaaaauucucaag    aaa gauuug ugua augguua cacaug    auaau         ugc aaaaaa    aagga  caagaaaaga  uaagg  auaagaaagucgagagua   cag u  u
    |||||| ||  ||||||||||| | ||||||||||||||   |||||||||| || |||||||||||||||| ||  ||||||| |||        |||| ||||| | ||  ||||   |||||| |||||| ||||  ||||  |||||   ||||||| ||||||||||||||||||||||    ||| |||||| |||| ||||||| ||||||    |||||         ||| ||||||    |||||  ||||||||||  |||||  ||||||||||||||||||   ||| |   
3'  aguugu ag  ggaguuugagu g aucuuuuugguuug   auuaagaagu ag aguuuauagguacgga ug  augguuu uaa        uccu aacuc g cu  ggua   uauauu gauaga gguu  ucga  ggggu   uuaucuu accuaguuuguuuuaggaguuc    uuu cuaaac acgu uauuaau guguac    uauua         aug uuuuuu    uuucu  guucuuuucu  guucc  uauucuuucaguucucau   guu a  a
   a      c  ug           a u              aug          c  g                a  uc       a   --------    -     a u  aa    auu      c      -    gu    uu     ---       u                      ---u   -      c    a       u      uuua     ucuuuucac   u      cuuu     ag          gg     ua                  -aa   g ag 
Get sequence
Deep sequencing
907 reads, 325 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00025: 4427106-4427691 [+]
intergenic
Database links

Mature sequence atr-miR8571

Accession MIMAT0033853
Sequence

50 - 

uucaaucgucaaguauccaugccu

 - 73

Get sequence
Deep sequencing508 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).