Stem-loop sequence atr-MIR8552b

AccessionMI0027456 (change log)
DescriptionAmborella trichopoda miR8552b stem-loop
Gene family MIPF0001863; MIR8552
Stem-loop
         u       a     aa  gu         c              a                  u            c a                            c               -a      c                         a   a    cu  uaauca   cacac  aau                 cuauu       aaca    -aa             ua 
5' uauaua auauaug aaaaa  ug  auuagucca uagcuuauaugaac uaugagcccaacggucua auugaaucuggg c aucugacgaucacggauguccgguagug uugaauuuuauuuua  uuucua aaauucaaaucacuugaaauuuuag ugu uguu  uc      agg     cu   aaaaauauuaaaaaaua     cgugaaa    aaau   ccaaaauaccccc  a
   |||||| ||||||| |||||  ||  ||||||||| |||||||||||||| |||||||||||||||||| |||||||||||| | |||||||||||||||||||||||||||| |||||||||||||||  |||||| ||||||||||||||||||||||||| ||| ||||  ||      |||     ||   |||||||||||||||||     |||||||    ||||   |||||||||||||  a
3' auauau uauauac uuuuu  ac  uaaucgggu aucgaguauacuug auacucggguugccggau uaacuuggaccc g uagacugcuagugucuacaggccaucac aacuuaaaauaaaau  aaagau uuuagguuuagugaacuuuaaaauu gca acaa  ag      ucc     ga   uuuuuauaguuuuuuau     guacuuu    uuua   gguuuuauggggg  u
         u       c     ag  uc         a              g                  c            a c                            a               aa      u                         c   c    au  uuuuua   acuua  agu                 aaaau       ---a    acc             uu 
Get sequence
Deep sequencing
18536 reads, 1.33e+04 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00025: 4480840-4481337 [+]
intergenic
Database links

Mature sequence atr-miR8552b

Accession MIMAT0033854
Sequence

389 - 

uaccggacaucugugaucgucaga

 - 412

Get sequence
Deep sequencing12223 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).