Stem-loop sequence atr-MIR8572

AccessionMI0027457 (change log)
DescriptionAmborella trichopoda miR8572 stem-loop
Stem-loop
   caacgauaggguggcgcguccccaguggaguugccagu        c         ca      ca   g c   aa    g     c       uu                         a  aca 
5'                                       uggucgga cugauuucu  ucguuc  ggu g ccc  auau gguga ccggucg  ggaauccucucucaaacaaucgcga gc   c
                                         |||||||| |||||||||  ||||||  ||| | |||  |||| ||||| |||||||  ||||||||||||||||||||||||| ||    
3'                                       accagccu gacuaaaga  aguagg  cca c ggg  uaua ccacu ggccagc  ccuuaggagagaguuuguuggcguu cg   a
   -----------guuuauguuuuacgaaguaucacacuc        a         ac      ac   g a   cc    g     u       cc                         c  ggu 
Get sequence
Deep sequencing
2749 reads, 850 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00028: 4881376-4881622 [+]
intergenic
Database links

Mature sequence atr-miR8572

Accession MIMAT0033855
Sequence

85 - 

ugacccggucguuggaauccucuc

 - 108

Get sequence
Deep sequencing2358 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).