Stem-loop sequence atr-MIR8573

AccessionMI0027458 (change log)
DescriptionAmborella trichopoda miR8573 stem-loop
Stem-loop
     ag     uu      uaacaaa   gu     ug           gu                          a   ug                             u 
5' cu  auugg  ucguua       gaa  ugguc  acgcaaugugu  cggaucagcuugucccuauugaagcc guc  gcacacauugugucagaccggcuucauua a
   ||  |||||  ||||||       |||  |||||  |||||||||||  |||||||||||||||||||||||||| |||  |||||||||||||||||||||||||||||  
3' gg  uaacu  ggcaau       cuu  accgg  uguguuauaua  guuuggucgaacagggauaacuuugg cag  cguguguaacacggucuggccgaaguaau a
     ga     uc      -----ua   ug     gu           ug                          c   gu                             g 
Get sequence
Deep sequencing
2777 reads, 1.62e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00029: 3790328-3790546 [-]
intergenic
Clustered miRNAs
< 10kb from atr-MIR8573
atr-MIR8574scaffold00029: 3795409-3795750 [-]
atr-MIR8573scaffold00029: 3790328-3790546 [-]
Database links

Mature sequence atr-miR8573

Accession MIMAT0033856
Sequence

123 - 

ccggucuggcacaaugugugc

 - 143

Get sequence
Deep sequencing1133 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).