Stem-loop sequence atr-MIR8574

AccessionMI0027459 (change log)
DescriptionAmborella trichopoda miR8574 stem-loop
Stem-loop
         a              u  u       c  ga g   a       u  c  a              u      auu           c   uu   a     c            u                  a  c              acaagauauuguaua 
5' ucaugu cuuuggauuucaaa ug gugguug aa  g guc uuuaaaa ga uc aaaguuaaaaaaaa aaauuu   gaacuuuauga uag  uaa ccauc aauuugacaucu augaguaagagugauugu ac uuuuuguaauaaaa               c
   |||||| |||||||||||||| || ||||||| ||  | ||| ||||||| || || |||||||||||||| ||||||   ||||||||||| |||  ||| ||||| |||||||||||| |||||||||||||||||| || ||||||||||||||                
3' aguaua gaaacuuaaaguuu ac caucaac uu  u cag aaguuuu cu ag uuucaauuuuuuuu uuuaag   cuugagguacu auu  guu gguag uuaaacuguaga uauucauuuucacuaaca ug aagaauauuauuuu               a
         g              u  u       a  gc g   -       u  -  a              u      --g           a   gc   c     a            u                  c  u              auaguuaucagagua 
Get sequence
Deep sequencing
463 reads, 1.5e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00029: 3795409-3795750 [-]
intergenic
Clustered miRNAs
< 10kb from atr-MIR8574
atr-MIR8574scaffold00029: 3795409-3795750 [-]
atr-MIR8573scaffold00029: 3790328-3790546 [-]
Database links

Mature sequence atr-miR8574

Accession MIMAT0033857
Sequence

115 - 

acaucuuaugaguaagagugauug

 - 138

Get sequence
Deep sequencing115 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).