Stem-loop sequence atr-MIR8575

AccessionMI0027460 (change log)
DescriptionAmborella trichopoda miR8575 stem-loop
Stem-loop
              --         aauc     auau   a   g                -    u          cu    ucg    u   u  g          u        c    c                 a          cu   a     u              uua         c   u   ag aa     uuuu 
5' aaacuuagaca  ucuuguugg    cuuuu    uga auc ugcuauaaaaguacuu aaug caccuaaaau  cacu   ccuu uuu uu aaauguugua agaugugu gugu ugaaaggucaauuuuga auugacguuu  gac cuugu ucuguguuagauau   cauuuguau cau uuu  g  acaca    u
   |||||||||||  |||||||||    |||||    ||| ||| |||||||||||||||| |||| ||||||||||  ||||   |||| ||| || |||||||||| |||||||| |||| ||||||||||||||||| ||||||||||  ||| ||||| ||||||||||||||   ||||||||| ||| |||  |  |||||     
3' uuugaaucugu  agaacaauu    gaaaa    acu uag acgguauuuucaugaa uuac guggauuuug  gugg   ggag aaa ag uuuacaacau ucuguaca cgca acuuuuuaguuaaaauu uaacugcaaa  uug gaaca aggcacaguuuaug   gugaauaua gua aga  c  ugugu    a
              ga         ----     gacu   c   -                a    u          ug    --a    u   u  a          c        a    a                 a          ac   c     u              --c         a   u   aa ac     ugau 
Get sequence
Deep sequencing
2792 reads, 1.12e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00029: 4695265-4695672 [+]
intergenic
Database links

Mature sequence atr-miR8575

Accession MIMAT0033858
Sequence

105 - 

agaugugucgugucugaaagguca

 - 128

Get sequence
Deep sequencing1846 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).