Stem-loop sequence atr-MIR8576

AccessionMI0027461 (change log)
DescriptionAmborella trichopoda miR8576 stem-loop
Stem-loop
        cua  guggg                        a       au                        u auuuc          -uua      aggggcuccacaauggugcggagcggg 
5' auaga   cu     uauauccuugugguuaguggagaa agccauc  acuggauuugucguaaaauugaga g     guuuccuucc    ucagaa                           g
   |||||   ||     |||||||||||||||||||||||| |||||||  |||||||||||||||||||||||| |     ||||||||||    ||||||                            
3' uaucu   gg     auauaggaacaccaaucaccucuu ucgguag  uggccuaaacagcauuuuaacucu c     cgagggaggg    agucuu                           c
        cag  -----                        c       cc                        c -----          ugaa      guugggagugaggggggaaacuuucuu 
Get sequence
Deep sequencing
602 reads, 175 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00029: 6178354-6178598 [-]
intergenic
Database links

Mature sequence atr-miR8576

Accession MIMAT0033859
Sequence

41 - 

agccaucauacuggauuugucgua

 - 64

Get sequence
Deep sequencing355 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).