Stem-loop sequence atr-MIR8577

AccessionMI0027462 (change log)
DescriptionAmborella trichopoda miR8577 stem-loop
Stem-loop
               c c             a                        a 
5' ucauguaucuga c caaauaguuggga aaggcucagaugaugaugaugaug u
   |||||||||||| | ||||||||||||| |||||||||||||||||||||||| g
3' aguacauagacu g guuuaucaacccu uuccgagucuacuacuacuacuac a
               a a             a                        u 
Get sequence
Deep sequencing
2718 reads, 3.44e+04 reads per million, 4 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00033: 798979-799089 [-]
intergenic
Database links

Mature sequence atr-miR8577

Accession MIMAT0033860
Sequence

28 - 

aaaaggcucagaugaugaugauga

 - 51

Get sequence
Deep sequencing1853 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).