Stem-loop sequence atr-MIR8578

AccessionMI0027463 (change log)
DescriptionAmborella trichopoda miR8578 stem-loop
Stem-loop
         u         c                 a gg    au 
5' aaucuu augagugau uuugcaauaguuuccuu u  aaau  u
   |||||| ||||||||| ||||||||||||||||| |  ||||   
3' uuagaa uacucacug aagcguuaucagaggaa g  uuug  g
         u         u                 g uu    gu 
Get sequence
Deep sequencing
8139 reads, 2.45e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00036: 3264771-3264860 [+]
intergenic
Database links

Mature sequence atr-miR8578.1

Accession MIMAT0033861
Sequence

5 - 

uuuaugagugaucuuugcaau

 - 25

Get sequence
Deep sequencing7727 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence atr-miR8578.2

Accession MIMAT0033862
Sequence

7 - 

uaugagugaucuuugcaauag

 - 27

Get sequence
Deep sequencing7727 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).