Stem-loop sequence atr-MIR8581

AccessionMI0027466 (change log)
DescriptionAmborella trichopoda miR8581 stem-loop
Stem-loop
   uuaa       a                       ug                     c  aua   g     ---ga     gg     g       caa            u        ug    c  a     u       a   a 
5'     cauccua ucgucguacuaaaauucucucau  uugguacuuaucuauauguuu gc   ugg uguuu     gagag  uuucu ccgaacu   guccccgacccg gaccucuu  ggcu gu gaaaa cuagguc auc a
       ||||||| |||||||||||||||||||||||  ||||||||||||||||||||| ||   ||| |||||     |||||  ||||| |||||||   |||||||||||| ||||||||  |||| || ||||| ||||||| ||| g
3'     gugggau agcaguaugguuuuaagagagua  aaccauggauaggugugcgaa cg   acc acaag     cucuc  aagga gguuugg   caggggcugggc cuggagaa  ccgg ua cuuuu gauccag ugg u
   gauc       c                       gu                     a  aac   a     auucc     ag     g       acc            u        gu    c  c     u       g   u 
Get sequence
Deep sequencing
2265 reads, 575 reads per million, 4 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00037: 1871777-1872076 [-]
intergenic
Database links

Mature sequence atr-miR8581

Accession MIMAT0033865
Sequence

267 - 

ugagagaauuuugguaugacgacu

 - 290

Get sequence
Deep sequencing1631 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).