Stem-loop sequence atr-MIR8552c

AccessionMI0027467 (change log)
DescriptionAmborella trichopoda miR8552c stem-loop
Gene family MIPF0001863; MIR8552
Stem-loop
      c                 gua     c  c    c         c         c           au        acau         - -a         u                           -   c        aaaa    ua --a   u     aa   c             c              a 
5' acc auggguugacugcuaca   aaugc ca ggcc agauugaau ugagccgau ugauggucacg  cucauuuc    uugaauuuu c  uuuuuuuuc acagauccaaaucacuugaaauuuggg ugu uauucuuc    auca  g   auc aauaa  aua aaaaaaaauaauu guaaaauauaaauu a
   ||| |||||||||||||||||   ||||| || |||| ||||||||| ||||||||| |||||||||||  ||||||||    ||||||||| |  ||||||||| ||||||||||||||||||||||||||| ||| ||||||||    ||||  |   ||| |||||  ||| ||||||||||||| |||||||||||||| g
3' ugg ugcccgacugacgaugu   uugcg gu ccgg uuuaacuua acucgguua acugcuagugc  gaguaaag    aacuuaaaa g  aaaaaaaag uguuuagguuuagugaacuuuaaaccc gca guaagaag    uagu  c   ugg uuauu  uau uuuuuuuuauuga cauuuuauauuuaa u
      c                 -aa     a  a    a         u         a           cg        cauc         u ca         u                           u   a        --ag    uc gcg   u     -a   a             u              c 
Get sequence
Deep sequencing
3951 reads, 8.45e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00038: 2385712-2386113 [-]
intergenic
Database links

Mature sequence atr-miR8552c

Accession MIMAT0033866
Sequence

332 - 

ggccgugaucgucaaauuggcuca

 - 355

Get sequence
Deep sequencing1338 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).