Stem-loop sequence atr-MIR8582

AccessionMI0027468 (change log)
DescriptionAmborella trichopoda miR8582 stem-loop
Stem-loop
   agc   ---c   c              g    a         ---ca  a  ---    uuua  uga 
5'    gag    uuu ucugcaaguuaugu auga cuccuacua     gg gc   gauu    uc   a
      |||    ||| |||||||||||||| |||| |||||||||     || ||   ||||    ||    
3'    cuc    aga agacguucgaugca uacu gaggaugau     cc cg   cuag    ag   a
   uca   cuac   a              g    -         auaag  c  aaa    uuuc  ugc 
Get sequence
Deep sequencing
385 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00039: 1732374-1732503 [+]
intergenic
Database links

Mature sequence atr-miR8582

Accession MIMAT0033867
Sequence

92 - 

uaggagucaugacguagcuug

 - 112

Get sequence
Deep sequencing341 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).