Stem-loop sequence atr-MIR8583

AccessionMI0027469 (change log)
DescriptionAmborella trichopoda miR8583 stem-loop
Stem-loop
         a        c        u a                       auu  uauca   c   accca      ----     ---c     u    a    aaccuagaccgguagcugagacuguauuccuaccccauaauuaguagucau 
5' agguca ggugguag accacuug g cuuagcuacuggacuagguuucc   cu     aug cua     uaauua    guggu    auaag ggga ugga                                                   c
   |||||| |||||||| |||||||| | |||||||||||||||||||||||   ||     ||| |||     ||||||    |||||    ||||| |||| ||||                                                    
3' uucagu ccaucauc uggugaac c gagucgaugaccugauccaaagg   ga     uac gau     auuaau    cauca    uauuc cccu auuu                                                   a
         a        a        u g                       -gu  ----c   u   ----g      accc     aaau     -    a    caguaccaucaucauggugaacucggagucgaugaccugauccaaagggug 
Get sequence
Deep sequencing
1873 reads, 1.08e+03 reads per million, 4 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00039: 3157489-3157787 [-]
intergenic
Database links

Mature sequence atr-miR8583

Accession MIMAT0033868
Sequence

15 - 

gcaccacuugugacuuagcuacug

 - 38

Get sequence
Deep sequencing1437 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).