Stem-loop sequence atr-MIR8584

AccessionMI0027470 (change log)
DescriptionAmborella trichopoda miR8584 stem-loop
Stem-loop
     ua  -aga a       a     uc a       uuu  a      aa     u   c           ca   c    ----       
5' gg  uc    c cuugguu ggugg  a gacauua   gg cacagc  ugacg cca gguucaaaucu  uug cgau    cuuucu 
   ||  ||    | ||||||| |||||  | |||||||   || ||||||  ||||| ||| |||||||||||  ||| ||||    ||||| a
3' cc  ag    g gaaucaa cuauc  u uuguagu   cc gugucg  gcugc ggu ccaaguuuagg  agc guug    gaaaga 
     uc  gccc a       a     ga a       --u  g      -c     u   c           --   a    aaau       
Get sequence
Deep sequencing
1232 reads, 400 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00040: 69933-70105 [+]
intergenic
Database links

Mature sequence atr-miR8584

Accession MIMAT0033869
Sequence

111 - 

ugaacccuggucgucgcgcugug

 - 133

Get sequence
Deep sequencing1214 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).