Stem-loop sequence atr-MIR8585

AccessionMI0027472 (change log)
DescriptionAmborella trichopoda miR8585 stem-loop
Stem-loop
        aa   ua  -gaga     c  g  u    cug  a         ga                aua    uua 
5' gauaa  gug  ga     gagag au ga gaag   uu uugucacag  gagaugauacugguug   uaga   c
   |||||  |||  ||     ||||| || || ||||   || |||||||||  ||||||||||||||||   ||||    
3' cuguu  uac  cu     cucuc ua cu uuuc   aa aacaguguc  cucuacuaugaccaac   aucu   u
        ac   ua  accaa     c  a  -    -ua  c         -g                -aa    ugu 
Get sequence
Deep sequencing
927 reads, 2.65e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00046: 3620895-3621047 [-]
intergenic
Database links

Mature sequence atr-miR8585

Accession MIMAT0033871
Sequence

44 - 

ucacaggagagaugauacuggu

 - 65

Get sequence
Deep sequencing531 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).