Stem-loop sequence atr-MIR8586

AccessionMI0027473 (change log)
DescriptionAmborella trichopoda miR8586 stem-loop
Stem-loop
   u    aua    --     -------------   u   u    a           u     c    ug       caaccucu 
5'  gugc   agga  ccgau             ggc uac uuuu cucuguuguug gagaa aaaa  ggaaucc        c
    ||||   ||||  |||||             ||| ||| |||| ||||||||||| ||||| ||||  |||||||        a
3'  caug   uccu  ggcua             ucg aug aaaa gagacaacaau cucuu uuuu  cuuuagg        u
   a    cac    ag     gcacaacaaguuu   u   u    g           u     u    ca       cuaacaac 
Get sequence
Deep sequencing
1093 reads, 2.68e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00048: 2976684-2976839 [-]
intergenic
Database links

Mature sequence atr-miR8586

Accession MIMAT0033872
Sequence

93 - 

uuuucucuuaacaacagagga

 - 113

Get sequence
Deep sequencing275 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).