Stem-loop sequence atr-MIR8616

AccessionMI0027474 (change log)
DescriptionAmborella trichopoda miR8616 stem-loop
Stem-loop
       c   caaagu  g   a  c  a  c       a  --c       gc    gugac   u     c        u       uc      g ac           -         uuc          cu               ---auu                   c     acccuaaaaa     a    ug   cc         a   --      a    u       c          u       u                ug        cg     caaaaugcucucugaaugaggauucgagaugaggcuuuacuuugauuucuuagaggcccgggccuuauaaaaucgaaagugcaauccgaaugagg 
5' agcc uau      aa uaa gc uc cc uaaaacu ac   gaaaauu  acuu     guu gaaaa cuucaaau gaucauc  ggccuu a  auuauaguugu gaaaaaaau   ggauuucaag  cuaaaaauaguguau      acacauuauuuagaucguc auuuc          uaagu uuca  gau  guaagaucu uau  uuuuuu agcu caaauuu auagucggug uggaaau gauuuuagagccauca  gagauuuu  augcc                                                                                               a
   |||| |||      || ||| || || || ||||||| ||   |||||||  ||||     ||| ||||| |||||||| |||||||  |||||| |  ||||||||||| |||||||||   ||||||||||  |||||||||||||||      ||||||||||||||||||| |||||          ||||| ||||  |||  ||||||||| |||  |||||| |||| ||||||| |||||||||| ||||||| ||||||||||||||||  ||||||||  |||||                                                                                                
3' ucgg aua      uu auu cg ag gg guuuuga ug   uuuuuaa  ugaa     cag uuuuu gaaguuua uuaguag  cuggaa u  uaaugucaaca uuuuuuuua   uuuaaaguuc  gauuuuuauuacaua      uguguaguagaucugguag uaaag          auuua aagu  uua  cguucuaga aug  aaaaaa ucga guuuaaa uauuagcuac accuuua cuaaaauuucgguagu  uucuaaag  uacgg                                                                                               u
       a   cucuuu  g   a  a  c  a       a  uuu       ga    aguca   u     u        u       ua      g ga           a         --u          ag               gaacau                   a     ----------     a    gu   aa         c   gu      c    u       a          u       u                uu        aa     acuucacaaaaagucuauuccgaaacuccacuuagagaugaaauacaaaauauuccggacccggagauacuuuaguuuuauuucggaauagagcu 
Get sequence
Deep sequencing
1930 reads, 2.68e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00049: 1238277-1239038 [+]
intergenic
Database links

Mature sequence atr-miR8616

Accession MIMAT0033873
Sequence

521 - 

ucaucgauuauaaaauuuguagcu

 - 544

Get sequence
Deep sequencing307 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).