Stem-loop sequence atr-MIR8587

AccessionMI0027475 (change log)
DescriptionAmborella trichopoda miR8587 stem-loop
Stem-loop
   aaaaaaa        u  cag  ug    u        u                      cu   u      u ua   ug   a     u         au           uacaaaaauaaa         cguc          - c         u 
5'        aagcauuu gg   uu  aaag ccaacuuu gaacugcccaaaauacaaaaaa  aau uguuug g  guu  aaa uccaa cuuucgaau  uccaaaacaca            aaaagaaaa    aaguguuugg c guucgaaag u
          |||||||| ||   ||  |||| |||||||| ||||||||||||||||||||||  ||| |||||| |  |||  ||| ||||| |||||||||  |||||||||||            |||||||||    |||||||||| | ||||||||| g
3'        uucguaaa cc   aa  uuuc gguugaaa uuuggcggguuuuauguuuuuu  uua acaaac c  caa  uuu agguu gaaagcuug  agguuuugugu            uuuucuuuu    uucauaaacc g caaguuuuc g
   uuuuuaa        c  -ca  gu    u        c                      uu   c      c gc   gu   c     -         gu           ------------         --uu          c u         a 
Get sequence
Deep sequencing
3667 reads, 2.35e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00049: 2701457-2701766 [-]
intergenic
Database links

Mature sequence atr-miR8587

Accession MIMAT0033874
Sequence

30 - 

uccaacuuuugaacugcccaaaau

 - 53

Get sequence
Deep sequencing3263 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).