Stem-loop sequence atr-MIR8588

AccessionMI0027476 (change log)
DescriptionAmborella trichopoda miR8588 stem-loop
Stem-loop
   uuacuccaggaaacgaaggguuac    a     a                                        cggucucgugagacuaggggucacagagauuaggcuuuaccagaacaacu 
5'                         ugga uuuug ugggaagagaugaaaaacaccgagcucccaggguuaaugg                                                  g
                           |||| ||||| ||||||||||||||||||||||||||||||||||||||||                                                   
3'                         accu aaaau acccuucucuacuuuuugugguuugaggguccuaauuacc                                                  a
   ------agugaggcuaugguuaca    g     a                                        uucaccagcgucucuaguccgcuacaucuaauuagaauagaaaacucaag 
Get sequence
Deep sequencing
4452 reads, 1.6e+03 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00004: 6062147-6062392 [+]
intergenic
Database links

Mature sequence atr-miR8588

Accession MIMAT0033875
Sequence

55 - 

ccgagcucccaggguuaaugg

 - 75

Get sequence
Deep sequencing3836 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).