Stem-loop sequence atr-MIR8590

AccessionMI0027478 (change log)
DescriptionAmborella trichopoda miR8590 stem-loop
Stem-loop
       c              a    c    c  g       c           --a                   u                           a   a     acaucuuagug    ac     au        a   c      --auu         u          a 
5' cuac cucaucacuguuca aguu aucg ac gucacga ugucugguagu   uuauuuuucauuuuuuuuu cuacaaaucggaaugaccugaaauuug agu uguau           aggc  aucua  aaaaauau uag aaaaua     cgugaaaag aauugaccaa a
   |||| |||||||||||||| |||| |||| || ||||||| |||||||||||   ||||||||||||||||||| ||||||||||||||||||||||||||| ||| |||||           ||||  |||||  |||||||| ||| ||||||     ||||||||| ||||||||||  
3' gaug gaguagugguaggu ucaa uagc ug cagugcu auaggcuauca   agugaaaaguaaaaaaaaa gauguuuagccuuauuggacuuuaaau uua acaua           ucug  uagau  uuuuuaua guu uuuuau     guacuuuuu uuaacugguu c
       a              a    c    a  a       a           caa                   -                           c   c     agcauuuuuua    cu     au        -   u      aaaau         -          u 
Get sequence
Deep sequencing
17237 reads, 1.33e+04 reads per million, 4 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00055: 4302007-4302363 [+]
intergenic
Database links

Mature sequence atr-miR8590

Accession MIMAT0033877
Sequence

270 - 

auuccgauuuguagaaaaaaaaau

 - 293

Get sequence
Deep sequencing3763 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).