Stem-loop sequence atr-MIR8591

AccessionMI0027479 (change log)
DescriptionAmborella trichopoda miR8591 stem-loop
Stem-loop
   uuc             u                           gag       c   a                  u           -ug           uaa             -             a  c   --             c    a              c     ucuuu              u     u               caa               a            caa a       c  c       u  a  ug     a                        a  g         a  ca      c               c   ga     a                a    c                          a       u    a  uc                g   g    u       agca     a   a               cu          a -   cac      u                    g   cc  c ug     cu a                       ga     ua          agaucc        -           a c                                aaau         c u   u     g                 u     c    c             c    c                 cggaa    ag          c    c    gacuuuuaauu       a       c     -  uac   a       a  u     u            g                ccuuagcuu       a           a               a  c            -       ac                        -  ---------      g                     cgg        g  uuua    guga       u        auuuacuauuccuuauaaauuuguauuuaaaggaaauaggucucuucucuguagagagagguuauuggagaauaaagaaagaguuugaucuuaugaaaagaacuugggcuggacaccuuugcaaauccugagagaugauauaaucucgcaa 
5'    uuuuuauuuauua uuuuuauaaguuuguauuuaaagggaa   guuccuu uuu uaaagagagguuauugga aauaaagaaag   uuugaucuugu   aagagaucuuggg uggacucccuugc ga ccu  gagaggguauaau ucuc agccuuuuuauuuu auuuu     ucuaguuuauuuuu auuuu ugcaucaguuggugu   agcagagaagaucca ccauugcaaugc   c aaaccua uu ugauaug au au  caugg acaaauuuuagaaaaucuaaccaa gu auggaagau uu  aagcga guucgugggaugaau agu  uugca cgguuggagaauacua uauu gagaagagggugcucgcaaccaugaa aucuaac ucag uu  acuguagagaugaauc agu ccac acugacu    gugcc auu ugaaugugacgauca  uugugaugca g aac   gauuug ggaauauccacaugaucuug uau  ag u  gucuu  c aguuuuaugaggaauuugaaaaa  aauca  auugagcucg      caguguuu auuucaagaug g auaaaguauuugaugaauugguuuauugaaga    guaccgagg g aug uggga uacaucaccaauuauuc auugg cucu aaggauguaagcu gagg cgagcuucuccuaaccc     gaga  aaugaugcaa uaaa aagu           uuauuuu uuuauau uuuuu gc   uua aaaauau uu uuugg uuuuuaguuuuu uuuaggguuauucuug         aguugua agauuuaaggg uagaauuggaaguuu gu uuuuuuaaaaag gauggau  ggauagggauuagcaugguugguu gg         gauaug uagacuuguuuuuaagagaua   gagagaua ag    gcuu    uuuuugu uuauuuuu                                                                                                                                                       g
      ||||||||||||| |||||||||||||||||||||||||||   ||||||| ||| |||||||||||||||||| |||||||||||   |||||||||||   ||||||||||||| ||||||||||||| || |||  ||||||||||||| |||| |||||||||||||| |||||     |||||||||||||| ||||| |||||||||||||||   ||||||||||||||| ||||||||||||   | ||||||| || ||||||| || ||  ||||| |||||||||||||||||||||||| || ||||||||| ||  |||||| ||||||||||||||| |||  ||||| |||||||||||||||| |||| |||||||||||||||||||||||||| ||||||| |||| ||  |||||||||||||||| ||| |||| |||||||    ||||| ||| |||||||||||||||  |||||||||| | |||   |||||| |||||||||||||||||||| |||  || |  |||||  | |||||||||||||||||||||||  |||||  ||||||||||      |||||||| ||||||||||| | ||||||||||||||||||||||||||||||||    ||||||||| | ||| ||||| ||||||||||||||||| ||||| |||| ||||||||||||| |||| |||||||||||||||||     ||||  |||||||||| |||| ||||           ||||||| ||||||| ||||| ||   ||| ||||||| || ||||| |||||||||||| ||||||||||||||||         ||||||| ||||||||||| ||||||||||||||| || |||||||||||| |||||||  |||||||||||||||||||||||| ||         |||||| |||||||||||||||||||||   |||||||| ||    ||||    ||||||| ||||||||                                                                                                                                                       c
3'    aaaaauaaauaau aggaauauucaaacauaaauuuuccuu   cagggaa aaa auuucucuccgauaaccu uuauuucuuuc   aaacuagaaca   uuuucuagaaccc accugagggaacg cu gga  cucuccuauauua agag ucggggaaauaaaa uaaaa     agaucaaaugaaaa uaaaa acguagucaaccaua   ucguuucuucuaggu gguaacguuacg   g uuuggau aa acuauac ua ua  guacc uguuuaaaaucuuuuagauugguu ca uaccuucua aa  uucguu caaguauuuuacuua ucg  aacgu guuaaccuuuuguggu auaa cucuucucccgcgagcguugguacuu uagguug gguu aa  ugauaucucuacuuag uca ggug ugacuga    cacgg uaa acuuacauuguuggu  aacacuaugu c uug   uuagac ccuuguagguguacuagagc aua  uc a  uagaa  g uuaaaauacuccuugaacuuuuu  uuagu  uaauucgagc      gucacaag ugaaguucuac c uguuuuauaaacuauuuaaccaaauaacuucu    cauggcucu c uac acccu auguagugguuaauaag uaacc gaga uuccuacauucga cucc gcucgaagaggguuggg     cucu  uuacuacguu auuu uuua           aauaaaa aaauaua aaaaa cg   aau uuuuaua aa agauc aaaaauuaaaaa aaaucccaguaagaac         ucagcau ucuaaauuccc aucuuaacuuucaaa ca aaaaaauuuuuu cuaucua  ccuaucccuaauuguaccaaccaa cc         cuauac aucugaacaaaaauucucuau   cucucuau uc    ugaa    aaaaaua aauaagaa                                                                                                                                                       c
   aau             u                           aua       u   c                  c           uca           --c             c             c  a   uu             a    g              a     -----              u     c               acc               c            acg c       u  u       c  c  gu     c                        a  g         c  ac      u               a   uc     c                a    a                          c       u    c  ga                a   g    c       gcuc     c   g               uu          c a   -uu      u                    a   au  c gu     ag c                       -a     uc          ----ga        a           g u                                guuu         u u   c     g                 c     a    c             a    a                 ----a    -a          u    u    -----------       -       a     u  -uc   c       c  u     u            -                -aaaaaaau       c           c               a  a            u       aa                        a  aaaccaauu      a                     -ua        a  -uaa    --aa       u        aaaucaaacauaaauuuuccuucuacagggaagaaacauuuauauuacuaaccucuuauuuuuuucucaaacuaaaacacuuuucuugaaccccaccugagggaacgucggggucuuucucccauaucagagaguuuuuacuuuuauuuuc 
Get sequence
Deep sequencing
6064 reads, 5.15e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00056: 1307335-1309688 [-]
intergenic
Database links

Mature sequence atr-miR8591

Accession MIMAT0033878
Sequence

716 - 

aaggauguaagcucgaggccgagc

 - 739

Get sequence
Deep sequencing3290 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).