Stem-loop sequence atr-MIR8592

AccessionMI0027480 (change log)
DescriptionAmborella trichopoda miR8592 stem-loop
Stem-loop
   uuauauaauac     --u                                 ccuaaucg     a    c                   u u                         ug   aug    g     c         u             ag                 u c          -      -ug     -au      gaaaaua 
5'            guaag   aauacuuuggaccuuggguuuucuacuugucau        uugga cuca aauguagguagguauugac g augaguucauuagaugagaagaggu  ccu   guuu ugccu uuuuggauc ucucucuagucuu  aagagcaagaagcaaca a uaucuugaaa cucaag   cagug   gaggug       a
              |||||   |||||||||||||||||||||||||||||||||        ||||| |||| ||||||||||||||||||| | |||||||||||||||||||||||||  |||   |||| ||||| ||||||||| |||||||||||||  ||||||||||||||||| | |||||||||| ||||||   |||||   ||||||       a
3'            cguuu   uuaugaaaccuggaacuuaaaagaugaacagua        aaccu gagu uuacauccauccaugacug c uacucaaguaaucuacucuucucca  gga   caaa acgga aaaaccuag agagagaucagaa  uucuuguucuucguugu u auagaacuuu gaguuu   gucau   cuucau       g
   --aauaaauca     ucc                                 --uacuua     c    a                   c c                         gu   ---    g     a         u             ga                 c a          u      uaa     aac      agcaauc 
Get sequence
Deep sequencing
236 reads, 375 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00066: 1786946-1787382 [-]
intergenic
Database links

Mature sequence atr-miR8592

Accession MIMAT0033879
Sequence

334 - 

aucuaaugaacucaucccgucagu

 - 357

Get sequence
Deep sequencing98 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).