Stem-loop sequence atr-MIR8593

AccessionMI0027481 (change log)
DescriptionAmborella trichopoda miR8593 stem-loop
Stem-loop
   uuc   gua   c                           ---                                          u             g                                      c                             u   a                              a       ug                acaucggaaggaaauaga 
5'    cua   guc auuccauaggucuuaauaaacccuuca   acuaaucuuacauuguauauguuaaccguaccaucagccaug acuucacauugua acccauuugcagcaaaccaacuucuucccuucugaagg ucaaccgguuuccaaguauuaugcuuaag aau cuuccauuuccucacacauagccucgugcc uuuagga  agcuaagaccucuaua                  a
      |||   ||| |||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |||||||  ||||||||||||||||                   
3'    gau   cag uaagguauccagaauuauuugggaagu   ugguuagaguguaacauauacaauuggcaugguagucgguac ugaaguguaacau uggguaaacgucguuugguugaagaagggaagacuucc aguuggucaaggguucauaauacgaguuc uua gaggguagaggaguguguaucggaguacgg aaauccu  ucgauucuggagauau                  a
   aaa   aaa   u                           cgg                                          c             a                                      c                             u   c                              a       gu                gagggauaaacaaaguac 
Get sequence
Deep sequencing
223 reads, 100 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00072: 189561-190053 [+]
intergenic
Database links

Mature sequence atr-miR8593

Accession MIMAT0033880
Sequence

273 - 

ucuuagcuuguccuaaaaggcaug

 - 296

Get sequence
Deep sequencing77 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).