Stem-loop sequence atr-MIR8565h

AccessionMI0027482 (change log)
DescriptionAmborella trichopoda miR8565h stem-loop
Gene family MIPF0001889; MIR8565
Stem-loop
   -----------guaauuuuguuauucaauuauguuaguauuuauuuuau   u   u     a     c   u  a         a  cu              ca                          ga       ----     u 
5'                                                  gag aau aucuu ugaga ccu cc cacucaugu ug  ggacuucaaaggau  accauuaaauuuggcauagaucuuua  aaaguua    ucaca g
                                                    ||| ||| ||||| ||||| ||| || ||||||||| ||  ||||||||||||||  ||||||||||||||||||||||||||  |||||||    |||||  
3'                                                  cuc uua uggaa auucu gga gg guggguaca ac  ccugggguuuucua  ugguaauuuaaacugugucuagagau  uuucagu    agugu a
   cauuauugguauuuaauauauauuuaagguuuaguggauuuauuuuguu   u   c     c     a   -  a         c  au              -a                          uc       uuaa     c 
Get sequence
Deep sequencing
4194 reads, 1.4e+03 reads per million, 4 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00076: 816642-816928 [-]
intergenic
Database links

Mature sequence atr-miR8565h

Accession MIMAT0033881
Sequence

99 - 

auuaaauuuggcauagaucuuuag

 - 122

Get sequence
Deep sequencing3391 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).