Stem-loop sequence atr-MIR8594

AccessionMI0027483 (change log)
DescriptionAmborella trichopoda miR8594 stem-loop
Stem-loop
   aac                                    a              uau                      a                     u   u 
5'    acaauucuuuuaucaacaguaucaauggauauguua gcaaauaaauguac   accuaaguauaauaauguaauu ucaagacaaagauagagaaag aga a
      |||||||||||||||||||||||||||||||||||| ||||||||||||||   |||||||||||||||||||||| ||||||||||||||||||||| |||  
3'    uguuaagaaaguaguugucauaguuaccuauacaau cguuuauuugcaug   uggauucauauuauuauauuaa aguucuguuucuaucucuuuc ucu u
   uua                                    g              ---                      a                     c   a 
Get sequence
Deep sequencing
490 reads, 325 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00081: 1136049-1136259 [-]
intergenic
Database links

Mature sequence atr-miR8594.1

Accession MIMAT0033882
Sequence

13 - 

uuaucaacaguaucaauggauaug

 - 36

Get sequence
Deep sequencing331 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence atr-miR8594.2

Accession MIMAT0033883
Sequence

27 - 

aauggauauguuaagcaaauaaau

 - 50

Get sequence
Deep sequencing107 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).