Stem-loop sequence atr-MIR8595

AccessionMI0027484 (change log)
DescriptionAmborella trichopoda miR8595 stem-loop
Stem-loop
          a             u                  u                -              u                                     ---         u   g     -   uc     u 
5' gggguaa ugaguguggauga gagccccuacccauuuuu gaaauagucaauuuuu gaauacguugguga aauggaggcuaaggccuucaauuggggcucagguggu   accaccacg cuc agccu auu  ugaua c
   ||||||| ||||||||||||| |||||||||||||||||| |||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||   ||||||||| ||| ||||| |||  |||||  
3' ccccauu acucacaccuacu cucggggauggguaaaaa cuuuauuaguugaaaa cuuauguaaucacu uuaccuccgguucuggaaguugaucccgaguucacca   ugguggugu ggg ucgga uaa  auuau g
          c             u                  -                a              c                                     uga         u   g     g   ga     g 
Get sequence
Deep sequencing
1172 reads, 1.28e+03 reads per million, 4 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00086: 1853597-1853880 [+]
intergenic
Database links

Mature sequence atr-miR8595

Accession MIMAT0033884
Sequence

186 - 

cccuaguugaaggucuuggcc

 - 206

Get sequence
Deep sequencing420 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).