Stem-loop sequence atr-MIR8596

AccessionMI0027485 (change log)
DescriptionAmborella trichopoda miR8596 stem-loop
Stem-loop
              c        gc                -g    a    a  ac   a  uug         u            -  -  -   uu    ug g   uuc  ca      a     uguuauuggaaaagcauuuca 
5' gcaagauggac auuuuuag  cuugaaauccauuuuu  ucag ucca ga  auc ag   gagaugauu auuuguagguuu cu gc cuu  gaau  a uuc   gu  agauuu aggug                     u
   ||||||||||| ||||||||  ||||||||||||||||  |||| |||| ||  ||| ||   ||||||||| |||||||||||| || || |||  ||||  | |||   ||  |||||| |||||                     a
3' cguucuacuug uaaaaauc  gaacuuuagguaaaag  aguu aggu cu  uag uc   cucuacuag uaaacguucaaa gg cg gag  uuug  u aag   cg  uuugaa ucuac                     a
              a        uc                aa    c    a  au   c  caa         u            a  u  u   uu    gu a   uac  -a      c     aguuaaacauuuuaacuccga 
Get sequence
Deep sequencing
1252 reads, 1.48e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00086: 2246834-2247127 [+]
intergenic
Database links

Mature sequence atr-miR8596

Accession MIMAT0033885
Sequence

259 - 

aaauggauuucaagcucuaaaaau

 - 282

Get sequence
Deep sequencing915 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).