Stem-loop sequence atr-MIR8597

AccessionMI0027486 (change log)
DescriptionAmborella trichopoda miR8597 stem-loop
Stem-loop
   u     -            cc   a           c               a       a   a a   c                  a         c                a    agaaaauacugaauuucaauguauuu 
5'  uuuug guacaauauuuu  uuc uuuuaugugua cuauauuaggaaggu guucauu cau u uua uuuuuuuagugguacaca cuuuguaac uuauaaauuggggcuc ugug                          c
    ||||| ||||||||||||  ||| ||||||||||| ||||||||||||||| ||||||| ||| | ||| |||||||||||||||||| ||||||||| |||||||||||||||| ||||                          a
3'  aaaac cauguuauagaa  aag aaaauacacau gguauaauccuuuca uaaguaa gua a aau aaaaaaauuaucaugugu gaaacauug aauauuuaaccccgag acau                          g
   a     a            ua   g           a               c       -   a c   a                  c         a                a    guguagaaguuauucgguacucccga 
Get sequence
Deep sequencing
1132 reads, 400 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00090: 2346852-2347146 [-]
intergenic
Database links

Mature sequence atr-miR8597

Accession MIMAT0033886
Sequence

76 - 

uuagugguacacaacuuuguaacc

 - 99

Get sequence
Deep sequencing578 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).