Stem-loop sequence atr-MIR8598

AccessionMI0027487 (change log)
DescriptionAmborella trichopoda miR8598 stem-loop
Stem-loop
   ---------------ucucucaaccuaaacccacgcgacccuaaacccucucuccuucaagcuuuugccuaacugaagccacucucucaa                        uugcuucccuacucu       g                              u        c    -   cc a             ggu        c                              c   ug                 g              a      c       c                       c   ---uuu                              aaa      ---c       g      a                             c c     gucgggccuuuggggccggcuuugccucaaauagguuugugcuuuuuuuuccccuuuguuauuguuauuauuauugucuuguuauuuuauuuuuaaagcauuuucaaacccccuacccauuuuccuguuuuuuuuaauuuuauauuuguuuugguucuaaggugaaguuuagucagcacgaucgguggugcgugaaugagaggucauuuuuagucaauuuuucagauauccauaauuugacggaacccuuauuuuuucugccucugaucgacgaguuugaaagggaaaucagguggaaauu 
5'                                                                                           cgucaagccuuucacccuccucuc               cccuuug agccauugggcgucauauuuucccuuuaca cuccaaua caag ccu  g ccucuucauauuc   gcucucua auccccacaaaagcgagcacauucacgauc aua  aggaucagugagaggga aucgaacuucagaa ccauau gagaccc gugaaggucccauuucaauucga gau      agaaauugagcgucucuggcucauccgucc   gacaac    ggaacgg ccccuc caccgacaaacucugauucgggccgucaa u ugggu                                                                                                                                                                                                                                                                                                             u
                                                                                             ||||||||||||||||||||||||               ||||||| |||||||||||||||||||||||||||||| |||||||| |||| |||  | |||||||||||||   |||||||| |||||||||||||||||||||||||||||| |||  ||||||||||||||||| |||||||||||||| |||||| ||||||| ||||||||||||||||||||||| |||      ||||||||||||||||||||||||||||||   ||||||    ||||||| |||||| ||||||||||||||||||||||||||||| | |||||                                                                                                                                                                                                                                                                                                              
3'                                                                                           gcaguucggaaagugggaggagag               gggaaac ucgguaacccguaguauaaaagggaagugu gagguuau guuc gga  c ggagaaguauaag   cgagagau uagggguguuuucguucguguaagugcuag uau  uccuaguuacucucccu uagcuugaagucuu gguaua cucuggg cacuuccgggguaaaguuaagcu cua      uuuuuaacucguagagaucgaguaggcagg   cuguug    ccuugcc ggggag gugguuguuugagacuaggcucgguaguu a acccg                                                                                                                                                                                                                                                                                                             a
   agagagucgcauuuggguacgcugggguuugggauagagggaguucggaaacggauagaguucggugagagggaguucugagagagagua                        ---------------       g                              c        u    a   -u -             ---        u                              u   gu                 a              a      a       a                       a   uugaau                              ---      uuac       a      c                             u c     aaccgaaguggaguuuaugcauacacgagaaaaaaagaggaaaaaaaauaauaaauaaaaauagaacaauaaaauaaaaauuucauaaaaguaggugggggugggggggggggggaguuuuuguaaacgauacaaaauuaaaagauaaaaaaagaaagauuccgcuucaaaucggcugugcuaaccgucaggcacuuuuucuccaguaaaaaucaguuaaaaacucuuagauacuaaacugccucggggaauaaaagauggauacuaguugaucaaauuugcucuuuaguucauuauuagu 
Get sequence
Deep sequencing
1928 reads, 6.55e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00007: 304230-305640 [-]
intergenic
Database links

Mature sequence atr-miR8598

Accession MIMAT0033887
Sequence

572 - 

uuuagucagcacgaucgguggugc

 - 595

Get sequence
Deep sequencing625 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).