Stem-loop sequence atr-MIR8599

AccessionMI0027488 (change log)
DescriptionAmborella trichopoda miR8599 stem-loop
Stem-loop
      aa             ug     c        c        u   c   aau       c        a    aac      uc      g                         g             ac      ucau          c     a     g      g   c      g  g   u     uau   -auau   uuuu     -aguaa   g 
5' agg  guggaguagagga  auaug caaaaugg uugaguuc aac uug   ugaguuc uucacaau uugu   uguuuu  auauag uaggugucuucaaguguugacaugu ucaaagugucaac  augucg    gcgauaccaa caaaa gugaa uguugu gug cguugu au aag agauu   cau     agg    uuaga      uau g
   |||  |||||||||||||  ||||| |||||||| |||||||| ||| |||   ||||||| |||||||| ||||   ||||||  |||||| ||||||||||||||||||||||||| |||||||||||||  ||||||    |||||||||| ||||| ||||| |||||| ||| |||||| || ||| |||||   |||     |||    |||||      |||  
3' ucc  caucucaucuucu  uauac guuuuauc aacucaag uug aac   acucggg agguguua aaca   acaaaa  uauguc guucacaggaguucacaacugugua aguuucacaguug  uauagc    cgcugugguu guuuu cacuu acagca cau guaacg ua uuc ucuag   gua     ucc    gguuu      gua a
      ac             gu     a        a        u   u   guu       a        a    --a      ga      g                         a             ca      uuuu          a     c     -      a   u      g  g   u     --u   auuuc   --cc     guaaag   a 
Get sequence
Deep sequencing
267 reads, 700 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00099: 2088970-2089422 [+]
intergenic
Database links

Mature sequence atr-miR8599

Accession MIMAT0033888
Sequence

26 - 

ccaaaauggcuugaguucuaaccu

 - 49

Get sequence
Deep sequencing54 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).