Stem-loop sequence atr-MIR8600

AccessionMI0027489 (change log)
DescriptionAmborella trichopoda miR8600 stem-loop
Stem-loop
                    c               -    aaaac   c     g   g      c          -     u             g                                              a   -    cuuu 
5' acuauggaguaauuuau auuguacucgauaaa uuug     uua auacc uug uuugua auggaguuuu uuuua uaaggguauuuuu gucauuaguaggggugugacgucaucuacauggggugugacgucac cua gugg    u
   ||||||||||||||||| ||||||||||||||| ||||     ||| ||||| ||| |||||| |||||||||| ||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||| ||||    a
3' ugauaccucauuaaaug uaacaugaguuguuu aaac     aau uaugg aau aaacau uaucucgaaa aaaau auuuccauaaaaa cagugaucguccccacacugcaguagauguacucuacacuguagug gau uacc    a
                    a               u    cugua   a     g   a      a          c     c             a                                              -   g    ucgu 
Get sequence
Deep sequencing
8067 reads, 2.3e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00103: 53962-54268 [+]
intergenic
Database links

Mature sequence atr-miR8600

Accession MIMAT0033889
Sequence

177 - 

aucucauguagaugacgucacacc

 - 200

Get sequence
Deep sequencing7676 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).