Stem-loop sequence atr-MIR8601

AccessionMI0027490 (change log)
DescriptionAmborella trichopoda miR8601 stem-loop
Stem-loop
   ----uguuuaugaagaaauuuugaacuc  gga        g  gc                 aaaauauu             a                     u              c      g 
5'                             ag   acguuugg au  gugaaaauacuuuugug        uuuacaugaaaga cucucccaugcgauuaggugu ggaguuuuuucaca caauug c
                               ||   |||||||| ||  |||||||||||||||||        ||||||||||||| ||||||||||||||||||||| |||||||||||||| |||||| a
3'                             uc   ugcaaacc ug  cauuuuuaugaaagcau        aaguguacuuucu gaggggguacgcuaauccaca ucucaagaaagugu guuaau g
   acuguacgugucuuuacaucucauguac  acg        a  ua                 --------             g                     c              c      a 
Get sequence
Deep sequencing
302 reads, 175 reads per million, 4 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00103: 2041972-2042220 [+]
intergenic
Database links

Mature sequence atr-miR8601

Accession MIMAT0033890
Sequence

90 - 

ugcgauuagguguuggaguuu

 - 110

Get sequence
Deep sequencing97 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).