Stem-loop sequence atr-MIR8602

AccessionMI0027491 (change log)
DescriptionAmborella trichopoda miR8602 stem-loop
Stem-loop
   uga   u    -c    u  uc                    ---a  u 
5'    gau ggau  uccc gc  aggagagaugaugccggcca    uc c
      ||| ||||  |||| ||  ||||||||||||||||||||    || u
3'    cua ccua  aggg cg  ucuucucuacuacggccggu    ag c
   aca   c    cc    c  ga                    acac  u 
Get sequence
Deep sequencing
11952 reads, 3.82e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00108: 1352014-1352110 [-]
intergenic
Database links

Mature sequence atr-miR8602

Accession MIMAT0033891
Sequence

20 - 

ucaggagagaugaugccggcc

 - 40

Get sequence
Deep sequencing11716 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).