Stem-loop sequence atr-MIR8603

AccessionMI0027492 (change log)
DescriptionAmborella trichopoda miR8603 stem-loop
Stem-loop
   gguguuuagcuguuugcaugccaaauacgagcuuacugacauccuaggcucaaaauucaua          -------       uuacuu      c         u              u aaaugcgaagacuuggaacgugaagguauggccg 
5'                                                              ccccucaucc       gauucuu      uacaug cgaaucaca gcucaaagaaaucc c                                  a
                                                                ||||||||||       |||||||      |||||| ||||||||| |||||||||||||| |                                   
3'                                                              ggggaguagg       cuaaggg      auguac gcuuggugu cgaguuucuuuagg g                                  g
   ------cuacgcuugacgggcggauccgaguuuuaaguaggggaaauccgaguuuuaaaua          uucuacu       -----u      a         u              u acacccuacagagguuuaaauggugggacuaucc 
Get sequence
Deep sequencing
1923 reads, 3.75e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00116: 1378281-1378580 [+]
intergenic
Database links

Mature sequence atr-miR8603

Accession MIMAT0033892
Sequence

199 - 

ugagcuugugguucgacaugu

 - 219

Get sequence
Deep sequencing795 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).