Stem-loop sequence atr-MIR8604

AccessionMI0027493 (change log)
DescriptionAmborella trichopoda miR8604 stem-loop
Stem-loop
            c       cca      a                 caa                    a                u   u     a                                g        -     ca      a       -aaau   ag    c          a   ugu  a          u         c         a a 
5' accucaccg auaugug   aaagga aaucaaaaggugcuccu   gaugccacuuguaagagugg agugcaugaaggacac uag gcaag gugaaaacauggugaggguaugaaaaaguuuu caaaagua uggug  ucuaca gaccaca     uca  uaga uagcagcuaa gaa   ug uuuugaaaca aaauuuuag aaaaagcua c a
   ||||||||| |||||||   |||||| |||||||||||||||||   |||||||||||||||||||| |||||||||||||||| ||| ||||| |||||||||||||||||||||||||||||||| |||||||| |||||  |||||| |||||||     |||  |||| |||||||||| |||   || |||||||||| ||||||||| ||||||||| | a
3' uggaguggu uauacac   uuucuu uuaguuuuccacgagga   cuacggugaacauucucacc uuacguacuuccugug auu cguuc cacuuuuguaccauucucauacuuuuucaaaa guuuucau accgu  ggaugu uuggugu     agu  auuu auugucgguu uuu   ac aaaacuuugu uuuaaaauc uuuuucgau g g
            u       -ag      g                 ugc                    g                u   u     a                                g        u     ua      a       gucuc   aa    u          a   uuu  -          u         u         g u 
Get sequence
Deep sequencing
921 reads, 375 reads per million, 4 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00116: 2036317-2036767 [-]
intergenic
Database links

Mature sequence atr-miR8604

Accession MIMAT0033893
Sequence

73 - 

caugaaggacacuuagugcaagag

 - 96

Get sequence
Deep sequencing525 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).