Stem-loop sequence atr-MIR8605

AccessionMI0027494 (change log)
DescriptionAmborella trichopoda miR8605 stem-loop
Stem-loop
   --   uac                a  g          g                              a               a  g  c      c      u                 --u         ugc   a                 gc         a   a              a c      c     c  cu  ucucauu 
5'   gua   aaugagaccauuuacc uu auacaaggug uuacaauuccuuacaacuauuugaugugaa uuugauaauuuggau ug ua aaaguu gagaaa uuucuuuugaaguuuga   cuuggucaa   aau auuguagccacccaauu  acauccaau guc agauuaaugugacc c uuguau aaagg aa  gg       c
     |||   |||||||||||||||| || |||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| || || |||||| |||||| |||||||||||||||||   |||||||||   ||| |||||||||||||||||  ||||||||| ||| |||||||||||||| | |||||| ||||| ||  ||        
3'   cau   uuacucugguaaaugg aa uauguuccau aauguuaaggaauguugauaaacuacacuu aaacuauugaaccua ac gu uuucaa cucuuu aaagaaaacuucaaacu   gaaccaguu   uua uaacgucgguggguuga  uguagguua cag ucuaauuacacugg g aacgua uuucc uu  uc       u
   ca   --c                a  a          -                              a               c  a  a      a      u                 cuc         uuc   c                 aa         c   c              c u      u     a  uu  ucucaua 
Get sequence
Deep sequencing
3021 reads, 2.35e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00135: 1278150-1278580 [-]
intergenic
Database links

Mature sequence atr-miR8605

Accession MIMAT0033894
Sequence

249 - 

cacauuaaucucgaccauuggaug

 - 272

Get sequence
Deep sequencing440 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).