Stem-loop sequence atr-MIR8606

AccessionMI0027495 (change log)
DescriptionAmborella trichopoda miR8606 stem-loop
Stem-loop
                cg   ug                    a  a              g                 -     cauguucccuugacuugugaaugggaucuaa 
5' uccaccgauucuc  auu  acauggguaugggugugacu au cgagucaccgaucc uuuuuuuaaaccuuggu uucac                               c
   |||||||||||||  |||  |||||||||||||||||||| || |||||||||||||| ||||||||||||||||| |||||                               c
3' agguggcuaagag  uag  uguacccauauucacacuga ua gcucaguggcuagg aaaagaauuuggaacca aagug                               a
                au   gu                    c  a              a                 u     uuacuguuuucaguaccuaaagaaucauauu 
Get sequence
Deep sequencing
315 reads, 275 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00140: 438128-438355 [-]
intergenic
Database links

Mature sequence atr-miR8606

Accession MIMAT0033895
Sequence

49 - 

ucaccgauccguuuuuuuaaaccu

 - 72

Get sequence
Deep sequencing245 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).