Stem-loop sequence atr-MIR8607

AccessionMI0027496 (change log)
DescriptionAmborella trichopoda miR8607 stem-loop
Stem-loop
       g    a  uu           a  c      c          a        cau     a    gu      c            g 
5' uauu aaua uu  uuuuuuuuuug ug uguuaa ugucuuaccc gguauagg   augga ccug  aucuag guugcgaaccua g
   |||| |||| ||  ||||||||||| || |||||| |||||||||| ||||||||   ||||| ||||  |||||| |||||||||||| c
3' auaa uuau aa  gaaaaaaaaau ac auaauu acagaauggg ccguaucc   uaccu ggac  uagauc uaauguuuggau g
       g    c  uu           -  a      a          a        --u     c    uc      u            a 
Get sequence
Deep sequencing
2353 reads, 650 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00161: 484165-484344 [+]
intergenic
Database links

Mature sequence atr-miR8607

Accession MIMAT0033896
Sequence

99 - 

uuuguaauucuagaucucaggcuc

 - 122

Get sequence
Deep sequencing2089 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).