Stem-loop sequence atr-MIR2111

AccessionMI0027497 (change log)
DescriptionAmborella trichopoda miR2111 stem-loop
Stem-loop
   u c   ------       --a  -    ug a                      guuuagcccac     u     -  uau 
5'  g gcu      aacuggc   ug agag  g uaaucuguaucuugagguuugg           aacua acuuc au   c
    | |||      |||||||   || ||||  | ||||||||||||||||||||||           ||||| ||||| ||    
3'  c cga      uugacug   ac ucuc  c auuggacauaggacuccagacc           uugau ugagg ug   a
   a -   cuccau       gua  a    cu c                      --aaaacccaa     c     c  uga 
Get sequence
Deep sequencing
7385 reads, 5e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00165: 819319-819473 [+]
intergenic
Database links

Mature sequence atr-miR2111

Accession MIMAT0033897
Sequence

25 - 

uaaucuguaucuugagguuugg

 - 46

Get sequence
Deep sequencing7294 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).