Stem-loop sequence atr-MIR8608

AccessionMI0027498 (change log)
DescriptionAmborella trichopoda miR8608 stem-loop
Stem-loop
   ----cacuuaaaagcacucaugagugaauuucuacauuauuuugcucauggcuuaucaccauccgaaguccauuagacaugaucguca    u           g   c              c                 --u   gac       c  u g   gg      aaaauaaaauauuaaaaauacaauccaaauauuaaauuaucucaaugaauauu 
5'                                                                                         aaua uguuuggauuu aau auuuuucuacagau agauugacuugaaauuu   gug   gugugcg cu a uga  uauacc                                                     u
                                                                                           |||| ||||||||||| ||| |||||||||||||| |||||||||||||||||   |||   ||||||| || | |||  ||||||                                                      
3'                                                                                         uuau acaaacuuaaa uug uaaaaagauguuua ucuaacuggauuuuaaa   cgc   cacaugu ga u guu  augugg                                                     c
   gugaauguuugugaguacucacuuaaagauguuauaagguaaauuccgaauauugguagguuucagguaguauuccaguguaaacaaa    c           a   u              a                 ucu   --a       a  u g   ga      auuuauuuauaaauuuuuauuaauaguuuuuuauuuuguuguuuuuaugggaa 
Get sequence
Deep sequencing
726 reads, 2.25e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00007: 2536778-2537225 [+]
intergenic
Database links

Mature sequence atr-miR8608

Accession MIMAT0033899
Sequence

108 - 

uuuucuacagaucagauugacuug

 - 131

Get sequence
Deep sequencing516 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).