Stem-loop sequence atr-MIR8609

AccessionMI0027499 (change log)
DescriptionAmborella trichopoda miR8609 stem-loop
Stem-loop
   u          auau           c              a                     a         c                                  ---u       acau    --------a       -  a      g 
5'  gagaaaauau    ggacuuauggc ucauuaaggauaug ccuuuaauagagcagaaugga aacuaagau cguguagcuaaucucaauuaguugggaaaaggcu    ugaugau    auga         auuuuaa cc uuggau u
    ||||||||||    ||||||||||| |||||||||||||| ||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||    |||||||    ||||         ||||||| || |||||| a
3'  cuuuuuuaua    ccugaauaccg agugauuccuauac ggaaauuaucucgucuuacuu uugguucua guacaucgguugggguuaauuaaccuuuuuucga    acuacua    uacu         ugaaguu gg aaucua a
   a          --cc           a              c                     c         a                                  uuuu       cuac    aacacuaug       a  a      a 
Get sequence
Deep sequencing
1754 reads, 3.95e+03 reads per million, 4 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00175: 147724-148020 [+]
intergenic
Database links

Mature sequence atr-miR8609

Accession MIMAT0033900
Sequence

66 - 

acuaagauccguguagcuaaucuc

 - 89

Get sequence
Deep sequencing714 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).