Stem-loop sequence atr-MIR8610

AccessionMI0027500 (change log)
DescriptionAmborella trichopoda miR8610 stem-loop
Stem-loop
   u   u    ---cccucucuccuac          g     u  c                     u          u         a   cuucuucc    cu a   -             auauuaag 
5'  uga cauu                ccaauguugu agauu cg uucagaaccuucuucgguuug ucagaaaaau aagcgcuuc gua        gauu  g gga agacuucggauuu        u
    ||| ||||                |||||||||| ||||| || ||||||||||||||||||||| |||||||||| ||||||||| |||        ||||  | ||| |||||||||||||        u
3'  acu guag                gguuauaaca ucuaa gc aagucuuggaggaaguuaaac agucuuuuua uucgugaag cau        cuaa  c ccu ucugaagucuaaa        a
   a   -    ccaauacaacgaaacu          a     -  a                     c          c         c   uaaaccgu    uc -   c             aaaaaaaa 
Get sequence
Deep sequencing
402 reads, 600 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00210: 197058-197317 [+]
intergenic
Database links

Mature sequence atr-miR8610.1

Accession MIMAT0033901
Sequence

49 - 

accuucuucgguuuguucagaaaa

 - 72

Get sequence
Deep sequencing157 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence atr-miR8610.2

Accession MIMAT0033902
Sequence

190 - 

uucugaccaaauugaaggagg

 - 210

Get sequence
Deep sequencing223 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).