Stem-loop sequence atr-MIR8611

AccessionMI0027501 (change log)
DescriptionAmborella trichopoda miR8611 stem-loop
Stem-loop
   cgg      guguuaca        u        c      c    g  c     
5'    agcgcg        uugucgga cgcucuua gccaug cgga cc cugu 
      ||||||        |||||||| |||||||| |||||| |||| || ||| g
3'    ucgugc        aacagccu gcgggaau ugguau gccu gg gaca 
   gua      --------        c        u      u    -  u     
Get sequence
Deep sequencing
215 reads, 475 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00413: 4554-4653 [-]
intergenic
Database links

Mature sequence atr-miR8611

Accession MIMAT0033903
Sequence

75 - 

uaagggcgcuccgacaacgug

 - 95

Get sequence
Deep sequencing130 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).