Stem-loop sequence atr-MIR8612

AccessionMI0027502 (change log)
DescriptionAmborella trichopoda miR8612 stem-loop
Stem-loop
   uuc      c                    a       u  c    uuu    c       cg                 a   c            a   u   g   c   u         uaa                -     a       c         a     u     a                   -    aagc             auauuuuuauuaaaagcaccucaguaagauguacauauccucaaaauuucaacccauuuugauuuuuaaaaccaaaauaaaaaauaaaauacuaccaaauaauugugaccacgcgaugaaauuuggacaugagaguagacaaaauuacuauucauuuuuaccucguugggaagacuuuuccaucca 
5'    aucgug gguuacgauugucugauagu uuuuauu uu auuu   uuuu uacaaau  gaaugaucugaaauuug agc uguguucaucaa aau agg aau uuu aaaaauaua   aaaaaauauuuuacau aaaua uauugac aaaauaccc ugaaa guuuu gggguauuuugguuaauuu guuu    ggauaauuuuuuu                                                                                                                                                                                          u
      |||||| |||||||||||||||||||| ||||||| || ||||   |||| |||||||  ||||||||||||||||| ||| |||||||||||| ||| ||| ||| ||| |||||||||   |||||||||||||||| ||||| ||||||| ||||||||| ||||| ||||| ||||||||||||||||||| ||||    |||||||||||||                                                                                                                                                                                           
3'    uagcgc ccagugcuaauagacuauca aaaauaa aa uaaa   aaaa auguuua  cuuacuggacuuuaaac ucg acauaaguaguu uua ucc uua aag uuuuuauau   uuuuuuauaaaaugua uuugu auaacug uuuuauggg auuuu caaaa ccccauaaaaccaguuaaa caaa    ccuauuaaaaaaa                                                                                                                                                                                          a
   aau      a                    c       c  a    --u    -       au                 c   c            a   u   a   c   c         ---                c     -       a         a     u     c                   a    aggu             acuuacucggagucauucuacauguaugagaacuuuaaaguucaguaagauuaaauaucuuuuuuugacuuuuuauuuugugauugucuguuugcacuggcgugcuacuuuaaaccugucauuacucccaucuguuuuagugauaaguaaaaacgguuauucgcaauucuucuuauauauauauau 
Get sequence
Deep sequencing
15459 reads, 9.58e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold03445: 1-805 [-]
intergenic
Database links

Mature sequence atr-miR8612

Accession MIMAT0033904
Sequence

324 - 

ugaccacgcgaugaaauuuggaca

 - 347

Get sequence
Deep sequencing207 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).